Słowianie i ukryta historia Polski

   wersja do druku 
Powrót na stronę główną 
Jeżeli chcesz otrzymywać informacje o Słowianach i ukrytej historii Polski, podaj swój email:

☼ Zapraszam też na Youtube: Słowianie i ukryta historia Polski - Sekwencjonowanie DNA youtube.png oraz na Facebook: Słowianie i ukryta historia Polski - Sekwencjonowanie DNA facebook.png Google+ Słowianie i ukryta historia Polski - Sekwencjonowanie DNA google+.png
☼ Jeżeli chcesz wesprzeć ten projekt, kliknij tutaj
☼ Krótki adres tego portalu, to: slowianie24.pl ☼

Sekwencjonowanie DNA

"Sekwencjonowanie DNA – technika odczytywania sekwencji, czyli kolejności par nukleotydowych w  cząsteczce DNA.

Sekwencjonowanie dokonuje się obecnie głównie za pomocą zautomatyzowanych sekwencjonatorów. Manualne sekwencjonowanie stosuje się przy opracowywaniu nowatorskich metod, w  niektórych laboratoriach dla krótkich fragmentów lub podczas ćwiczeń[potrzebny przypis].

Przykład sekwencji DNA (początek operonu laktozowego E. coli z  GenBank):

GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG
…" [1]


Literatura:
1) Wikipedia
Sekwencjonowanie DNA
https://pl.wikipedia.org/wiki/Sekwencjonowanie_DNA



  •  

zobacz:



XXXXXhack#190

Zapraszam też na Youtube: Słowianie i ukryta historia Polski - Sekwencjonowanie DNA youtube.png oraz na Facebook: Słowianie i ukryta historia Polski - Sekwencjonowanie DNA facebook.png Google+ Słowianie i ukryta historia Polski - Sekwencjonowanie DNA google+.png Nowy portal Wolnych Słowian i   Wolnych Polaków "Słowianie i  ukryta historia Polski" jest w  ciągłej rozbudowie. Zapraszam do lektury, część artykułów jest w  trakcie realizacji. Zapraszam wszystkich Wolnych Ludzi do udziału w  tym projekcie. Piszcie, fotografujcie, kręćcie filmy - opublikuję Wasze Dzieła związane z  losami naszych przodków z  waszym podpisem. Autor strony: Marian Nosal